Commit f9461e15 authored by Axelle Loriot's avatar Axelle Loriot
Browse files

Auto-saving for axelle.loriot on branch master from commit 38f4ae17

parent 38f4ae17
Pipeline #73168 passed with stage
in 20 seconds
Version: 1.0
RestoreWorkspace: Default
SaveWorkspace: Default
AlwaysSaveHistory: Default
EnableCodeIndexing: Yes
UseSpacesForTab: Yes
NumSpacesForTab: 2
Encoding: UTF-8
RnwWeave: Sweave
LaTeX: pdfLaTeX
This diff is collapsed.
@DRR016707.1 DGTKZQN1:354:C2B0UACXX:5:1101:1199:1908 length=101
NTGANGCTTAGGTAGGGGTAGGGAGACAGGGAAGTAACAGAGGTACTGGACATGCCAGGCAGAAGAAACAGCAGTACAGGACATGGAAGCAAACAACATGG
+DRR016707.1 DGTKZQN1:354:C2B0UACXX:5:1101:1199:1908 length=101
#0;9#4=9@<><>?????@=@???@???????<?>?=?=?<?????????????????????<@<???=?<=?<::<==<;<<==<;<<<<==<<<<<<=<
@DRR016707.2 DGTKZQN1:354:C2B0UACXX:5:1101:1245:1922 length=101
CCTGNACCCAGTAGAGAAAGCCCTTCGAGATGCCAAACTAGACAAGTCACAGATTCATGATATTGTCCTGGTTGGTGGTTCTACTCGTATCCCCAAGATTC
+DRR016707.2 DGTKZQN1:354:C2B0UACXX:5:1101:1245:1922 length=101
@@@D#2ADHHHAAF<CFHIGHIIGGIHIECGFAHDHIIIGGGIBGG?FHHHGGEHIH=FEGDDGI@GIIGIHHEHEDDBACCDCECB@BCBCCBCBBBCC@
DRR016707.26395247 147 1 19626495 60 101M = 19626490 -106 GTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGGAAGTTGTAAGG DDDDDDDDDDDDDEEEEEEEFFFFFFHCHHHJJJHHJJJJJJJJJJJJIHFJJIHJJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJHHHHHFFFFFCCC AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP NH:i:1
DRR016707.26395247 99 1 19626490 60 101M = 19626495 106 CTTCTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGGAAGTTG CCCFFFFFHHHHHJIJJJJIJJJJJJJJJJIJJJJJJJJJJJJJJJHHIHIJJJIJJHIJJJIIIIIIJGIJJJJDHJJJHHHHHHHFFFFFFEDACEEDD AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP NH:i:1
DRR016707.34969377 163 1 19626487 60 101M = 19626493 107 ATTCTTCTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGGAAG CC@FFFFFHFHFFHGGJCIFJGHIIIIGIIIIJIIJJJIGIIIIIIGII?:BFHGHIIIIGEHHHGIIDGGH@GGIGHJGHHHHCEHDEFDDFFEEECCEC AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP NH:i:1
DRR016707.34969377 83 1 19626493 60 101M = 19626487 -107 CTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGGAAGTTGTAA CDDDDDDDDDDDDECEEEEEFFFFD?=HHHHGIIGEGIGIIIHIGDIHHGGGIIHGHIIIIGIIIGIGEIIGGGIIIIGIIIIGHDIIFHHHHFFBDD?C@ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP NH:i:1
DRR016707.42561021 161 1 19626495 60 100M1S = 19626494 0 GTAACAATGTTATCAGTAATGCTTTAAACTAAAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGGAAGTTGTAAGA ?8?B1:BDD,,2<:C<2A<<,+A?CBFFAE<+<+2A?EEBD99:D<*?B:*:D9B:DD/BDED@)=8=B;@=)).=(=@;7A)7.==>;3);@AAA>A@3; AS:i:-8 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:30C0C68 YT:Z:UP NH:i:1
DRR016707.42561021 81 1 19626494 60 101M = 19626495 0 TGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGACACCAAGTCTGTTTCTTGTTTTGTATTTTCGCTCTGGAAGTTGTAAG (9(??==3??>==;5(55((6.((9>;..;67>)>).5(A;;>=/))8.=>9)((?AB?92=00*;=::1)=:3=74=A7<)0<+<AAAB?=<+4AA<;== AS:i:-5 ZS:i:-19 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:54A29T16 YT:Z:UP NH:i:1
DRR016707.43465443 163 1 19626483 60 101M = 19626486 104 TGCCATTCTTCTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTG B@@FAFFFHHHHHHIIIIJJJHJJIJJIIJJJJJJJFJJJJJJJJJJJJJHIJFHJJIJJJIJJIIJIJJHIHHIIIJJJJJHEHHHFEFFFFFEDEEEEE AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:-1 YT:Z:CP NH:i:1
DRR016707.43465443 83 1 19626486 60 100M1S = 19626483 -104 CATTCTTCTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGGAG DDDDDDCDDDDCCDEEEEDFFFFFDBHHHHHGJJGHDJIJJIGIHJGGJJJJJJJJJJJJJHG?JJJJJJJJJJJIIJJJJIJJJJJIGHGHHFFFFFCCC AS:i:-1 ZS:i:-12 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:100 YS:i:0 YT:Z:CP NH:i:1
DRR016707.64407509 147 1 19626484 60 101M = 19626484 -101 GCCATTCTTCTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGG DDDDDCDDDDDDEEDEEEEFFFFFFHHHHHHJJIJIGHFIHJJJIHFIHHFJJJJJIJJJJJJJIHJJJJJIJJJJJJJJJJJJJJJJHHHHHFFFFFBB@ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP NH:i:1
DRR016707.64407509 99 1 19626484 60 101M = 19626484 -101 GCCATTCTTCTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGG CCCFFFFFHHHHHJJJJJJJIJJJJJJJJJJJJJJJJJJJJJIJJJJJJIJJDGIJJJJJJJJCGIJJJIIHHJJJHHIJJJHHHHHDFFFFFFEEEEEED AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP NH:i:1
DRR016707.68628658 163 1 19626487 60 97M4S = 19626487 -105 ATTCTTCTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGAGAT CCCFFFFFGHHHHJJJJJJIJJJJJJIJJJJJJJJJIJGJIIEIIJJJIE:DGIJJJJJJJJJJJIJIHIJGGHJJJJJHJHHHHHHFFFFFFFEEEDEDC AS:i:-4 ZS:i:-17 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:97 YS:i:-4 YT:Z:CP NH:i:1
DRR016707.68628658 83 1 19626487 60 4S97M = 19626487 105 ATCTATTCTTCTGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTG EDDDDDDDDCDEEEEEEEFFFEEFHCHHHHHIGJJJJIHCIJJJJJIHIJJJIFIJJIJJJJJIIHFJJJJJJJJJJJJJJJJJJJJJHHHHHFFFFFCCC AS:i:-4 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:97 YS:i:-4 YT:Z:CP NH:i:1
> SEQUENCE 1 (Fri Sep 18 13:05:43 2020)
GCGCCACCTTCACCTGTTGTCGAGTCCGCCGACACCAAGAACCTACCGCA
CCCTATTCCTTGGGTTCATTATAGTGTCAAGCGACACGACAAACGTAGCG
GAGATGGTGTCTCGAGGAATGATCTTCAGATATGATCTCAGAGAGGCGGT
CCGTCTTGGAAACTGGCACGGGTAACGCTGCTTCTTCCCGGCAACGAGCA
TCAAAATCACTCGGGGGATCATCCTGGGCCGTCCTCTTTAATTTAGTGGC
CATGGCGCAATATCACAGGGTACAGTCGCAACGATTGCTAAAGGAGTGAG
GAGATTTTCGAGTCGGCATAGATGCTAATACCATGCCACGGAGCGTAATC
TTGCCGCATCCCTGGTTACTTCCATTTCTCCAGCCATGCGACGGAAATTT
GCGCTGACCCTGAGGCATTATCAACTTCCGGTAGAACAGCTATAGCATCG
CCTCGTGCGCCTTGCCTTTTTAGCTATGAAACCTTCGTCATCACAGCGAG
CTGCCATGCTGGCGCCACTGTACAATCCTTGTCGCGCAGCCTACGTGCAC
AAAGCCGCGCGTAACCACTCACTTGCTGTCTGTTCTGTTCAACTGCAAGG
AAACTCGGAACGTGGACAACCCGGAGGTATGGCAAGCTGCCTTAATACCT
GAAAGAAGCTTTTGACACAAAAAGACTGGGCATATTGTCTGGGGTATATC
GCGCCAGCAGCCCCACGTGAAACACGCAGCATAAGTGAGCTGTGACGGTA
GGAAAGACGGAACTCACAGCGTCTCCGATCCAAGGAAGAGAGTTAATATG
TACGAGTTGTCAGGAATTACGTGCACTCGCACTATTACGTAATAACCTAC
TTATCGTTGAGGTTATCTGTGTCGCTCGGAAGAGTCATCAATTGGTGGTT
GCGGACCCGGCTCCTCAGGATCTTACCACTTTGTATACAGTATCAAAACA
GGTGCACCGTAATTATTCGTGACGAGAGGAGGCTAAAACTCTGACTGCCA
AGACCCCTGGGGCCGTTCTAACGGCGCATGCGGCTACCGTTGCTAAGTTG
AACATCGGTCACAAGAGATCGTTAAAGTCAGAGGTACTCGACGGCTCATT
GGGCCCCGACTGTTACTACCAAGACATCGGCGGTTTTGCACTATATAGTC
ACCGAGATTCTAGAGCCAGCGATGGGTGCCCCCAACCTGGGCCGGATTTA
AGAATTGATCGACAAATTATTCATCACATCGCTGTCATATTCGTGGACAT
AGTGTGGTATACCTTGCCTACATGCACTCGTTCCATAATAATTTCTTTCC
TGGCAATTCGGGCTTGTTTCACGATAGGTCGACCCATCTCAAGTTCTGAA
ATGATTGTTCTTGGGGACCGGTACCTTAGTGTATAGATACTTCTTCACCC
AATGCAGCACGGTACAATAGGTCCTAGGGAATGGGTGGTAAAAGGCTTCT
ATCAACACGCGCTTTCCTAGGGACCCATGTGCTCCGCATAGTGGAATGAA
ACTTGCTGATCTTTACACTATGTAAGCCTCTAACTGTGGATTGGAGTAAT
TTGGGGTGGTGCGCTAGTATACCCTCCGCACGTAACAACAACTACGGTGT
CTAGTACGGGCACCTCACCGAGAGCTGTTTCGGTTTGAGCCGGCTTCTTG
AATAGTAGCGAGATGGCGCTAAATTGATCCCGGTCTCCCAATCCGTAGTC
CAGCATGGCCGAGGTAAGAGGGAGAACCGGCTCTTTCGCAGTCAAGCGGT
GAAACTACAGATCCAGCTAAGTCATACCTGGCAATTCTAGGGTCCGTCGC
ACCCTCAATTAAGTACGAGGTTTGTGACCAGACTTCAGCATCACCATTTA
TCTGGGAGTTGGTACGTCAATCTGGTACCATCAGTCGCAATTTCTCAGAA
TAATACGCTGGCAAACCAGCTACTCCACTACACATGTCCCCCCCTCAAGG
GTCTCAAATTTGTAGGTTATTGTATTTGCGCGTGTGGGCACTACAGTGAA
CTTGTCGCTTGTGCGTCTAGGTGTTTCTGATTGAACTAATTACTGCACCA
AGTTCGCTGATAGTCAGCGACAGGCTCACGTAGCATGCCAAGACCGACAA
AAACGCCTTCTCTTAGGTTACATATAATCGGCGTGCCCGAAGAAGGCTGA
CACCTTCTCCGCCGCCTAAGAATGGGCCATTATAGAAAGCGCGATATCTA
CAGCCGTCCGTTCTCATCGGATGGCTGCAGAACATTCGGGTGAGTCTGGT
ATCTCCAAAAGTTTTCTCCTGTTCGATCTCCTGTAACTCAGGCCCTCAAT
CCGTCTGTCACCCAGTTTGGACTCAAATGTGGGGCTAAACCTGTCGGTAC
CCATACACATCTCAATGCCCCGAAGGTTACACTGACACGCCCTAAAGGCA
AATGTACAATTTCGAGTTACAAGCGGCCCCTTGCTTTGACAGATTCCGGT
TTGACAGAGTAAATTTGTGCGGTCGGTTTTATCGCTTGTAGTCGATTAGC
> SEQUENCE 10 (Fri Sep 18 13:05:43 2020)
ATACACTTTTTGGAGTTCGCCTCATAGGTGAGCAGACTCGTCAAACAAGT
CCTAGATGAGGCCGAATCTGACTGCAGCCATAGTTACCTGTACATCGCTT
ATGCTTCGAAGGCCCAATGCTTCACGAACACAGTATGGCAGCAGTTTTGT
TCCTGACGCGAAGGTCAGGCCGTAGTACCGGTTCGTTGTAGTGTCCTGTG
TGCTCCTGTCTCGACCCTTATCGCAAGAACACCTCGTCGGTGCGTCGATG
GGCGCAGAACTATCTTTCTTTGTAGTTTCTGACGAACCCAGAGAATTAAA
CTGGGTGAGAAGATAGCACTAGTTTTTTGCCTAAGAAAGATAACCACAGC
CTCACGTACTTAGTTCGCATTTAACAATAAATTGGGGATTTGAGATCGTA
ATTTCGCCCCATAACCTCCGCCAGTCGTAAAGGTAAAAGTGCACCTGCTG
TCATGAATGCAGTCTGCTTCGGATGCCCGGCAACTGTAGGGGCATTAAGC
CTTTAGTGGATACACGCTACCCCATTATAGGCTGGTCAAAGCTGTTCCGA
GCCCATCCAAGCTGTCTGAACTACCCTCTCCAGATGTTCATGATAGTTGC
TCAGATAAGATCGACACTCTCCCCGAGTGTGCTAGTTAGCGGATTCTGCG
TCCAAGGCCTCATGTTTTATAAATTGTGGGAAAGAAAGGACCTTAAGCCG
GGGGACAGTTTTAGGCGAACTCTAATCAACTTCACGTGCCTCCCTCACCC
GACGCTGTTCGGAATTCTGCCCGAGGTTTTGGGCCTTACATACACAAAGG
AGACACCACTACGCGCCTCTCCCAATGACGGGTGGGAGCCCATGGGTGAA
TTATTTTGTCGCAGCTCTCAATTAAGGCGATGCATATAGGTCATACTAGG
GCCGAGGCGCCCGATTACAGGATGAAAACCGTTGACAACCTCCAGAGAGC
TCTAGGAAATGGGTATTGAATAGCAGTATGCAACACCCTACATTCCGAAC
TTAGTAGGATTAACTTCGATCAGCAACGACGTGTATCACCACAGCCGACG
TTCGGACCTTTATAAGAGTCAAATTGCCAGAATTCGTTCCGTGAAGTTCA
AAATCACTGACAAAACGTTCGCGACAAATGGTGCGTGTGTCGACGAATTG
AGTTGTCACACGCCAACAATATAACACCTTTGGTGTATACTCGATGACAC
GCAAAATCTTCTGATCGTTTTGACGATGTTTGACATCAAACTCACTGCAT
AACGCCGGGTATCACGGCTTACAGGGGATTACTACCTCTCATAACGGGAG
ATACCTGAAGTGGCCTCGGGTAATTTATACTAGCACTATACAGGGAGACT
ACTAAAGCTCCTAGGGGGCCATTTATGTTAACCGAATGCCTCGTTATACC
CAACGGGGCCGTTACAACTACTCACGCACCGCCAGACGACATGGCACCCT
TCCTGCACTTAGTGCACCCTAGGACGCTCCTCTGGACGAACTCCCCGTAA
CCGGCTTTCGAGGCGAACAATAATCCCTGCGTCAGCGGGTTCGTCCACGG
CTAATTGACGGGACGGTCACCAGGGCGTACGTTCCCCCCAGTTCCTATAT
AAGAGGTCAAACTGTGAACTGCGCACAGTGTCTCAGAGCTCTTGTTTAGC
TAACCTCATACTGCGAAAGCAGCCACCGGCATTATGCATAGGTGAGAGCT
ATAAGTCATGACCAAAGTGAGCTAATATTGTGGCATAAAGGATTAGGAAA
GACTCGTGTCTCATATGCACTGAGCTATCTTCGAGAAAATCATTTTCAAC
GCCACTTGCGCATTCCTTCCACCCACTCCTCCATATTTTAGGGAAGGATA
CCGCGGAGGATCAAGCCGGAGAGTCACAGATGTGTCACCGACGTGATACT
TTAACGTCGACAAACTTTTCAGGATGAGAGTTCTGGCTTCCTCGTCTGGG
GATAATGGCTCCTAGTGTTGCCCCACTTGGGCTAACCTTGAGACTGACAG
AAAGTCTCGCGCTTCAACGGCCGATCTGTAGGATGGCGGTAGTGGAATTA
ACTCCTAGAGACTCGTGCTCTCAAGTACAGCTTCTACGAGCTATTTCCTC
ACTCAGCATCCCATTGCCCATGTATATTTAGCGTATCGTTTGGTTAATCG
GAAAGGGCCCATTTCTCGCTAGGATGACGACCCCGTCTAAAAATCGTAGA
TAAATCCGCGCTGCTACATTTATACCATGCATTAGGGCCACCTAGGGACT
CCACAAGGTACCTTGGGTCACATATGGGTCGAAATTCCCCATTATAGCTC
TACTCAGCGGTTTCCGCAGAAACGGCTAGGTTTCATCGCTCGACTTACAA
TTGGTCTCGGACCACTCTTAGACTAGGTATAAGCGAAATAATCGGGACCT
GGCCCTCCTCCGTGCGCCCTGAACCATCTACTGTTCGAGGGCAGTAGTGT
GTTGACTCAGGCGATGGAAGATGTACTATAGGGGGATCCCCAAAAACAGT
> SEQUENCE 100 (Fri Sep 18 13:05:43 2020)
CGTTTCATGCAAGTATTGGGGTTTAGGCGTAGAGCACGGCATACCGAGGT
GAGGTATGCCTAGACCGGGTCTTCTTGGATCCCGGTGCAACCCAAAGAGG
TCCCTAACGGCGCACGACTGATCTATTCTATATATGCATGTTTGAGCTCA
AAGTCGCTGAGAATTAAGTGGAATAGGGGGGGATGTAAAACTGCTGCCAG
GAAGCATCGCTGGTTAAGCGTCAAATCGACGGTGAGGATGACTCGCGAAC
TCGCTGAAGGCCATGACGTAAGACGTATCTAGAGGTTAGTCAGCAAGCTC
ATAGACTGAAAAAAATGTTGTACCCACTTTCCTCGTTAAACGCGCTGTGG
CTGACAGCCCACATCCGCCATGAAAGGATTCCAGGTGAGATTGTACAGTG
GCTAGTGTACGGCTCGTACCGGAAAGACTCGTTACGCCGCGCCACCTAAA
GGTTCAAACGACAGTTCGGCCAGCTTTTTACGCTCAAGGGGAAAATACCC
TGCTGTAACTTCATTGTTCGAAGCGCCTCTTAAAAACTGGCCCATAAGAG
CCACGTGAACCACTTAGACATCTGTAACCACATTATAGGAACTAACTCAG
CACCCTGTCATGTACTCACAGCCCTGGCCTATCCGACCGGAGCCCGAATA
CTTCCTTACTTCGACGACCGGAATGAGGAGAGGGGTTGGCCTTTAGCACT
CTGTCATGGTGGGGAGAGTTGGAGTATCAGTTACTGTTACCTTCCACTGA
TCATCCTGTAGTTTTAGCCGGTCCTGGGGGTAAGCATAGATGTGAGAATC
TATGAAGGACGGCCTGTCTCATGGAGGAAAGAGTTTACTTACGAGTCGGA
ACAAGCCCTACGTATGAGACCAGCGAGCACCCAACTAATTCGGCGAACCT
ATTTTTAAAGCCGCAACTGTCGGGCCTAGAACGTATCTAAAACAACTCGC
CCTGTATACCAGTGGTACCAAGGGGTGTGCAGTGATCAGGTATCTCACAT
TCTGTAAGTGGTATGGTAGTATCTCCTGGATTCCAAACTTAGTGTGGGTT
GCCAACTCTAGCCGCGACCTATCGGATGCTCTCGCGCGACAGTTCCGACT
CGATAACGGCGCTAACTGATTTTTCGCATCCGGTAACTCGTCGATAACCG
AAATCTACCGTTGATAGGTGGAGGACAAAGCAAAGACCTATCCTCAATTG
AAGGTGTCAGCTAACATACTTGTCGGCCGCCACTAAACAATCGCTTTGGT
GTCCCGGATATTGTTCAGCGTCAGTATTCCGGATCACGGGGGTTCTACTG
AACTCTGTTGCGCTAGAACATATAGATTGCCAAGCCTCATGACAACGCCA
AGGGTGAGGTCGTCGGTGTTTGGGCAGAAGCAGGTACCCGATATGCCCGA
CGCGTCTTTGATCGCCAGCCAACCATGAGAGTACTAGTTGCGAACGCGTG
GTCGCTACCAACGAAAGTGGTCATTAATAGCGTCAGATCCTTCCCCGTTT
AAACCGGCGATCGGTTGTCCACCTTTACATCAGTTTTGACAGTAAATTAT
ACGACTCACATCAAGGTTCAGAAGCCGCTCCCAGGCCTGGTCCACGACGG
CTCGCCGGCTACCGTGCTCAAAAACTGAGGGAGACATAGTCGGCAGAATT
TTCTAAAGGACACACTTTTCCCTATGGTAGGCGATAGCATCTAAAAGTTT
TAAGTGCATTCTGCCTCGAACCGAGATTCGGCTAAAAAGGAGTAGATGAA
AGACATGCGTACGAAGCAGGTTATAAGTTTCCGAATAATGATTCCAACCA
AATCTTTGAGCGGGCGCCACCATTACTAGATTGGGTCAGCAACAGGAAAT
GGGAGAGTTCTCAAAACGACGAGAGCGATATAGTGGTGTTTCTGGGATGA
CAACCATGATAGTATCTATCTTGAGTCGGCTCCCCTCCTCGGCAGGCGAC
TATTGAGGTGATAGAAGGAAGTTTTGGCTATCGATCAGGAGGGTGTTTTT
GGAAAACATGTGGTCAACTGAACGGCCCATCTCCTGCATCTTGGGGTATC
TACCCACCAAATTGAGCGATGGAAAATGACACGTAGTTTGGAAACGTGAA
CGATAGTTACGGCAACACCCTCCCCCGCATGGGGTGTGTCTTTTCGAAAG
CGAGCAAATCTATAACGACTATTGAATCGCAGCAGTCACTCACCGATGTC
AGTTTATTTTCGGCGTGAAAAAGCATCGTTTTTTGTATTGCTGTGAACCG
ACAACCGAGTGACGGGAAGAGTGCTCGGATGTTAAGAATGCAGCTGATGT
GGGAGCACCCTCTATATACAACAGCTCAAGAATAAAGCGAGAGAGTGGCC
AATCCCAAATTGCAATCAGCTAACCGAGATCTCCTGTTGAAGCGTTAAGA
TATCGCATGAGCCTCTAGTCTGCAAGAACTATGTGTGTTTCTTCTGGTCT
GAGCTGCTTGAGGCGAGGGCGTTAGAAACCTGGTTCCCAGACCTGTATGT
> SEQUENCE 11 (Fri Sep 18 13:05:43 2020)
TCGCCTTAATAGAAATTCTCTCCCGTCGGCAAGCGAAAACGCTTCTCCTA
TTAGTCCAGATGAACAGCTATGCGCCCGCGCCCACGACTACATTGTGCAT
GTGGGTTTGCACTTGGCAATCTCTCTGCGAACGAGATAGCTGCTAAGAAC
TGTCCCATTGGCGGTGATATTTTCTGCTAGTCAGCCCCCAGGCTACGTTG
AGTCCCGGCATAGAAGAGCTCGTGTCTTTAACGGGGGACATTTTCGGGAA
CCCCTAAGGTAGCTTTACCCTGGGCCAGCCCCATCTTGGCGGCTGTGACC
CGCGACGCGTGCTTTACAGATATCAATGCCCTCAGTTCAGACGCTTTGGA
GAAACAATTGCACCGCGACTGCCGCGCCTATACAAAACGGCGGCAGGCTG
TGGGTTACAGATCGAGGGTCCCATAACGGGCACGTATGGCCAATAGCCTG
GAGAGCTAATGCAAAAGGCGTCCGGGTATCTCGTATTCAAAAACTGACCC
AATTAGAGTATTCCGGAAGAAGGTGTGGACGCCAGTAACAGCTACCGTAC
GGATGTCACCCCGTGACTAAATCATAAAATGATCGTCTTTTATTTATCTG
CGGAGTCTGATTTGACCTAGCCGTACCCCGAGCGCCCCATGTTGGAGGAT
TTAAGCAATTTGGTCCATAGAAAGGAGGGTAATTCCACTCATATGCGCTC
CTCTGAATATGTGTTTGCGACGGCCACCGACACGTAAAAAGGGGTAAGCC
GAGTCGCTGCGAACGGAAGTAATGATATAACCAACAGTACATTGGACGCA
TCGTCGAGCTGTTAGCATGAGAGTTTGCTAATAAAAAGCTCATTGAAATG
CCCTGGGCTGGGAAACACGGTGCCGCGATCATCCAACACGCAACAGATTG
TGACACTAGGTTAGACGAGCCAGACTAGAGTGCTTTGAAAGTCGCCCCTT
GAGGCAGGATCACTGTACGCTGGCCCCCAGGAGGATCGAGTATCGCGGCC
GTAAATCAACAGAGGTGCGCTCACCAATACCATTCTCCCGACAAGTTTGT
TTATACCGTCCGCATTAATCAATACAAGACATAATGCGCTGTCGGTGCCC
CCGATATCCTATACTTCGGTCGCGACGGCGAGCTTGCCGTCACCTGTAAC
TTCTTTGCGCAATGTGTGAGTACACGTCAATTCGACAGACTACCGTAATC
CGCTAAACAGTCAGAAAAAATATAGATGAACCGGGCAATAATGCGTACGA
GGCCAAATTTAGAAGAATTCCAAGCACAAACTGACCAAGGATGAATAGGC
CGGGGTCCGGGTCCCCTCTTGATTCTGGAACGGCGACAAAATCGCAGACA
ATGCGGCAAGGCGTTCTAAGACATGGGAAGCTAATCTTTAAGGGCTTTCA
AGGGGTTTGTCGGACCTATGGGTGGGCCCGGTTCTTCCCCTGCTAGACAG
TTTCTAGCACGTATCTGAAGAAGTAACGACTGCAGAGTTCGACCATACGG
GGACCGGTCTGTCTTTTGAGCATTAGATATGCCAACTAGTAGCGCTTATG
CTTGGGGTCGCTTATCAAAGAAAGCAAGCTCAGATTAGGTTCACGTGGCC
GTGAGTTTCAGCAGGTGAGAGATAATAAACCTCTTACCGTTCCGCACTGT
TATAAATTATGTCTTTAGCTACGGATCGGTTCTATCGTATGCAATTGAGT
TTTTAGCATGCAGTCTCAGCCGATAGCCGAGTGAACCCCGCTTCATGGTA
CCGCTTGTTCCTTCTCCCAAAATGCGATACTCCGGTCAGCGTAGCTCTGC
TCGTGTACCCATTGTCCCGGAGCCGAGTATTTATGTGGCACGGCGTCGCT
GACAGCGAGTTTAATTGATGCAACCCAACCCTCTAAGGCAAATAATCAAG
CCTCTAAATACTCGGATTAGCTTACGTAAACTATGTTTTGGGCAATCATT
ATCTGGCGTACTAGGACAGATGATCTATGATACATCCACAGTGTGCAAAG
TCATTGCTCACAATTCCTAAATTCCGTCCAAGCCAGAAACATGCGCATCT
ATCAGAACAAGGGTGGATCGATCTCACTCGTGGGTCGCTACGACCTTTAA
ACAGGCGCAATTTTGACTTACACTGTCCCACTATAACGTGCGTAGGTGAT
CCGAGTCTCATTATGGGGATTTCAGACGGGTCTCCCCCCAAGTATTATGT
TACCCGCGCTGACTCATGTCATCGCGGCATTCCGCCCAACGTCGTGAACT
ATAATCGTTCTACCTTTCGCACAAACTTACCCAGAGGTGCGAAGTATGGA
TATGGGCGAAGGGAGGGTAACAACAGGTTCTTTGAGGCAACAGCCAATCT
GTCCGGTCTAAGTAAGCCGTCGTCTTCAGGTCTTTCGCATGATTACGGCG
ATAGGCCTTTAGGTACCGAATTAATTTGAGCTTACGTGCACATCAAGTAA
CCTCCAGCATAACGGTGAAGGTCTATCCTCCTTAGACGTCACGGTACATC
> SEQUENCE 12 (Fri Sep 18 13:05:43 2020)
CTTCGTTGAACGAGAGTGGTCGCCATTGCGCATATATGAAGGAAGTTGTT
CATCCTCACTGAGACGACCGAATTAATGAGCTGGCACAGGAAGCTAAGCA
TGGACGGCCGCGGAGTCCCGTATTAGATCCGGGATACCTCTTGTTTGATA
CGGTCGCGCTTATTACAAACCTTATCATCGCGGATAGATGTCGGTTACTA
CATCTCCTAAATCAGTCAATCGATGATCCGTATTCCCACCATTACTGTGG
TCTGATCTCTTTAGCTTTCATTCTTTATGAGGAGTTTTAAAACCAGTAAT
CCGCGGCTCCGATGGGTAAACCACTGCAGTAGACTAAGGAGGTACTTTGT
CGCTCGCGGTCTCGCCCACCTTTGCCGGGACAGTCCCCCTATGGAAGTCA
CATCGAGGGGCGTACGTGGAGGTGTCATGACCTAGGCATTTTAGAGCAGC
TCTGGAAATAGTGAAGTATGTGGAAGTAACACCACACACCGGTACAGAGA
TCGAGAGTTCCTAGCGACAGGAGGCCGTAATAAATACAACAGGGAATCTC
GGAGGATCTCGGATGAAATCTCACATAATGCCTCTGATCGAAAATAGTTA
GTGAGAAAGGGGTTGCGAATACCCTAGTATCGATGTTCCTGACGGCGACC
ATTTCATGTCATCCGGAGTTACGGCCGAAGACTTTTGCATCGAGGGAGGA
TCCAAACCCTCGGAACCGTCTTGACACCTCAATCTACACATGTTTGGACT
TGACTCTAGGACTGCCACTACTTCACTCAACGACATGGACGAGTGTCTTA
GGTTATTCTAGTTATAACGCCTATTATCCATGGAGTGATTGTGCCTATAT
ATAAACGGACTAGAATCTTGTACGATTGATTAACAATCTGGAGTCCTTGT
CCAAAACCATAGACAGTCCAGTATCCCCTGACATGACTACTCGTGCGTCA
AACAGGGATGCGTATACATAGGGAGCACGTCCGCTGCGAAGTCGATTATA
CTGCGGTAAATTACGCCCACATCCGGTCCTCTTCCACTGACGAGGACTAG
GTACGACAAGATACCCTATAGATTATCAATCTATTGAACAACTTCCACGG
CTTCGCTCTACGCATTCAAGATATCGGCGGAGTGCGCCTGGCGTACGGAT
AGAATTGTCACAACCGCCTTAAAGTCAGCATATAGACCTCACCTCTCAGT
ATGCACTGCTCGGTGGAGATAAGTCTCTGTGTTTTAGAAATGGGATGGTC
AATTGGTACAGCAGCTGAGCACGCCTAAGGAATGGGGCGCTTAGGTAAGA
TCCGATTGTAACCGTACGGCATAACAGAACAATATGAGGTCTAATGCACG
GCAACGTTCTCAACCCCCGCAAGCGGGTTGCGGCTTGCGGCAAGCTCTCT
ATCGAACACTTGGCAACAAGATTCTAGCAGGTTATAGTGGGGTGTTCTAT
TAGTCGTGCACACTTGTGGTGAAAGCGAGCTAGCATAACGAATATTGGGG
AGCTGTATCCACGGCACCTTTACCTCCTTGTGGTATCTCTTCCTATGTAA
GACCTCGGTAATAACCCTTCGCGGCGGTTAGGGAGTTATGCCACGAGGAT
ATCTTCAATACTCGAGACCCACGATAAGGAAGTGCCGGGCAGTCGATTGA
TTGATACGATCTCAGCGTATATCTCAAGAGAACTGATGACCTTAGGAAAG
CCACTACATGCCGTTTAGCATTTCCGTAACGTAACGTAGTTATCTGATTA
CCAGGTTCAGCCAGGGTGCTGGGCCAGCATGAAGATTGCACACTGAAGGG
TACCGGGCAATTAGGGGTCGTAAACGCCTTTAGGTACCAGAACTGCTCCA
GGCAGTTCCTGCTCCGCCAAGCACAACGTTTACAGTATTTAACCTTATAG
ATAAGTTTCCAGCACATATCGCTCAACGTGGGCGGGGATATTGTTCTTGT
TGGTCTGGTAGCCAACTCGCGCTGTTGACCTATACACACAGATGCCGTTA
TGCTGGCCAGCCGACCGAGACTCCAGACATGTGCAGATATTCATTCCTGT
TATGCGATTCGCGTGAAAATTATTAAAACGCTCCTAGCGGACTCAGCGTG
AGGAGCTACGCTTTCCGACGAGAGGACCTGATAGACAAATGCAACACTGC
TATATTTTCTGCGCGGTTAAATTTACGACACTACTGGCGATCTTACACCC
ATGCCACGGTGGATACGGCGATTCTCCTATGAGAACGGCGTAGCGTCTAA
CGAGGCCCGTGTGGGTGGCAGTACGGTATTCAATGAGGCAAAACGGCCGA
TCCTATGCCCAGTGGACATGTACAAGGCTTGGATCCGGTTATCCTCCAGC
GTAGTCTCACGCTTCTTGTAGAGTATCCCACGGGGTGCACAACGTGGGCT
GTTTGGCGACCAGTCGCGGAACATAATTACCATCGCTGTGACTCTTTCGT
CATAGCAGATCTGCTTGTCGCACCTGATAGCGCAAGCATTATCAGCCAGG
> SEQUENCE 13 (Fri Sep 18 13:05:43 2020)
GCAACGAATAGCTAGGAAATTGATATATCTTCTTTGAGCACTTAGTACAC
AAGAGCAGAGCACGGTAGAGGCCTTCACCATTTCAGGCCCGCAGAGATAA
TCAACAGGTTCAGGATATAATTTTTAGTTATTACCACTGTCATATATATG
TTGTAATGCCATGCCGTAAGGGAGAACCTGAGCATAGTGAACGTCAATTA
CGAAGTTTGCTGTAGGAGTAAAAGGAGGGCGAGATTTGCGATAGAGGAAC
AGCCTAGAGCGTCTCGTCCGGAATGTGCAAGCATTCCCCGATTCCTACTT
CTAGAACTTCTGGGGAGTTTCCATGATGTATTTACGCGTTTGAAAGTCTT
GTACCGCCACTAGAAGAGGGTTAACGTATTCCTGAACGCCGCTGTAGCAT
CAGAGAAGTTTACCGCGGCCAGTGACAGTAGGCGATCCAGAGCATTTAGC
GACGGGATCCGACGTGCTAGCTAACTATGTAAGCACCAAAACCGTGGATC
TCTATAAATCACTAGTGCGGGGAAGATACTCGGTTAGCACATCGGTTGAG
AAAGGTCGCTACAGGTTCCGCGGACTGCGGGGGGTCGCGCGGGTCCTGAG
TGACCTTGCCGTAAGTGAAGCCCGGCGGCCGTAGAGAGACTACGCTTATC
TAGCCTATGGTAACATGTATCCTCAACGCAGAGAACGTTAGTGTCACGCG
TGTATGGGAACGGTAGCTATAAACGGACAATATTAGTTTGCAATTCGACA
CTGCTACCCGCGTCGGACCAACAGCCTTAGGTACGGTCTATCCAGGACCA
CTGCCATCACGTAGTAAACATCAAAGGACGCTTCGAGTATTAGGGACGGT
TGTGGCATTGCCACTAGATTACGCATGTATAACTAACCGATGCTAGCAAC
GTGGTGACTCGAATGAAGCTTTACCTGCAACCCCCAGTCCTATAAGGCAC
ATTGCCCCAAGGAGTGAGCTGGCCGACCCCCCCAACGGCTGACAACCGTG
GGGTACACGATTGTGCGTTTCTACACGTGGAGAGGCCTCTCGTAGACTCA
GTCTTTAAGGATTTACGATTTAGAACGTAAGTAGATGAACTGCTGACGCA
ATCCGGACGTCTCCGAGCGGTCGTAGGGAGTCGGCCAGAGGTATGGAGTA
AGAGCGCTCCAACTACGTAGATCAAGTGACTGAGGTATGATAGGACAAAG
CAGCAAAACACCGCTGTCCGTCGGAGGAGTGGTGAAAATCTCATATTCCT
TTAGAGCTGGCTTGCATTGCTCTAATAACAGCCGTACGTCTCTTCCATTA
TTCGTTTAATGGGACCTCTCTAACGCACGGTCGGCCGGTTCCCGACGTTA
TTTTCTAGCCTTACTATATAGCGCCGCAAAACAGTGATACGGCTCGGGAG
AGCGCCATACAGCAACCTAAGGCTTAGGCATTGGGTTGGAGCAAGTAACA
TTCGACACCTGGTGGTCGCACACACTAAATTTGGCTCCAATGAGGAAATC
CTGGCCGGGAACTGAGACGGATTAGCGCCTCCTCTAATCCTTTGCCCTCC
CAAAAATCGCATGCAGTCAAGGACGCGCCATGTTCTGACCAAGCTTTAGC
CAAATCTGCAACCTCCCTTCGTCTGTTACAATCCAGTCCGACCGTAACTT
ACCGCTGGCGCTCTTTATTCTCCAAATTTATACGGATTCGGGTTCGGTCA
AGCATACCTCAAGCACATCTAAAAAACATTGGCGCTGAACACCCGAGTGT
TTAGCAGATGCGAGAGAAAGACTACTTAATAGTGGGGTGTCGTGTGTATC
TCTTACAGGTTCCTACAGAGGAAGGTACAACCTCTAGACGAATAGGTCCA
GGAATACTTTTATACCATTATGCTTCTCTAGCCTGGTTCTCATCACTCTA
GCGAGTATCACCTTTGCCAATCGACGGAGGGTCAAACGAATTTGGCCTAG
ACCGGTACGCACTGCTCGTCGGGATTGCACTCTCTGACATGCGAGTTAGT
AGAACGCCTCCATACCACTCTAAAACTTGGTTATGATACGTCTCCGTCGA
AGTGTAGGGGTAGTGTTCAGCCTTCAGGGCACTGTTTGAGAGGCCCCGGA
AGAATGAAGTAAACCTACACCTGAAGACTTAACCTGTATACTCTTCGGAT
GTTTGAGTTCGATGCCCGTTCTGGAACCGATGGCCGGACCGAGTTTCAAA
CCAAAAGTCACAGGGTATCAGGTAACTGAGGGGAATACCCCGTGTGACCG
CATAATTTCGTAGTGTGCGTTCGGTCCTACAATCATTCTCAAGCATGGGA
TTACTGCTATCGGGCCTTGATAAATGCTATATGCTTGAATACTCAAAATG
TACAGAATGTGTATAACGGATTGGGTCTCCGTACCGCGCAAGGTGTTTCA
TCTGGGATTGCGGGACGGGTGGTACGTTGGGCCTGGCCTCTTGCTATTTG
CAAGAGTATGAAGAGAGTTGTATTCCTAGCCGTTGCTTAGATGTGTGTTT
> SEQUENCE 14 (Fri Sep 18 13:05:43 2020)
TCTCTTATGACTTCCTGGAGAGGCATAATTCATGACACTCCGCGTGCCTT
GAGTCCAGTAGAAGGGCTGCTCGTCCAGTCATATTGCGTGGACTCGAAGT
TATAAAAATTAACCAGCTAAGACAAACCAACGCACATAGACAGCACCGAG
GCTGTCGATAACTAAAGCTTCCTCTCAGGACATCACCGGAAGACTGTTTT
GTAGTACCTTCGTAGACGATGTCGATATCAAAATAGAGTGGAGTCCTGTG
AGCCCTTTAGTTGTTGGCATCGGGCGGCATGGGGGTCGTCACCCTCTGAA
GAGCACTTCCTTGCTCGCATTTAGGATTCGCTAAGGTATCACGGCATATA
ATTGTATAAGTTGAAGTATATAACGACTCGACTCTCGGGCGCATGCAACT
ATCTGTATAAGAGTGACGTACAAGAAAAAATTTATGCCTTGCCCCGGGAG
GCATCACAGACTCATAATTCTGCTTGTGCCAATTGGGCCAGCCGCTAAAA
AGATATGAAAGCCCAATGACTACCGATAGCAGTGCAAAAGATCGCCTGTC
TTGAATAACTAACCGGTCCTTTACGCATAAACAGGAACCGGAGATCCGTT
CCCCTCGAGGGCTGATAAGATTAACCCTCTGCGCAGACTTAAAAGCCGCT
CTGGTGGCGTTATCGCAGCTCAACGAACGCAGACTTAAAGTAGTACCCAT
TCTGTTGCCGGAGGATGCGCACTAATAACATTCACGGCGGTAGTGCCACA
ACCGTGCTAGTTGCCAGCTCGATGTTCGGTCAGTTGTGGTCCCGTACTTC
TAGCAACTAAGCACAGCAGATGAGGGATTCTCTGACGCAAATTTGCAGGC
AATCTTGAATACCGGGACATTAGGAGTTGTAATGATTCCGGTGTATCAAG
CACAACGCCAAAGTATGGTGACTTCCTGCTACAAATGGTCTCAATCATTT
CCAAATCCGGTACTAGTCTCCCCCACTACCCAGTCCTTCTTTTCTTAGTA
AACTTGTCGATTCTTAAGTAATCCCAAGCAACACGTGTTTTATGTCAATA
GCGTTGGCAGACCACTTTCTGCAATCAGAGAAAGGCCGGTTGCATCGGAG
AGTTTTTGAACTTTGTAGCGCATACGGCTGCTCCTTGTGCTCAAATGCAA
GATCAGCGTCGCCACATGAAGGGGAATGCCCGTATAATCTGCCGGTTCGC
TATTGGCAGGTGCTATTCCACTCGTGCGCTATGGATGCATTATTCACCAG
ACTGGTTGTGCTAAACCTCTGTGTCGTCCGCCTCTGGCGCTTGCCGGAGC
GCGTAGGCAAATAGGAGTCCCCCCCAGTGGTCTCACCGTGACTCGAATTC
TCCGCAAGGGCTCACACAATATTGGCATATGAGGAGCTATGAACACTATA
GGGATGACCATCTGCTGCTGAGGGGGGAGAGAAAGTTGTCTGAAGATCGG
TAACCCGGGGCAATCCACGGACAATTCCCCCTTGCGGTAAGGCTAATAGC
TTAAGTCAGTCGCCCTTTACGTTTACTTAGCAGAGGCCTCGGTCTCGCGT
GCACATCGTTAGCTCAAAATGACGATTCTGCATCGGCGCACGGATCACCT
TCCTCATTCGCCGGAGACCCGACGGAATTTTAAGCTCCGTCTATCTCTCG
TCCTTAATGAGGTAGTACATATGTCTATCTGTCTCTGGGAATTATAGGTA
GTTTAGACCCCCAAACGCCATACTAGTCCGGTGGGTTGTAGCATACTGGT
TTAGACAATCTGGAAAGACGAAGCACAGGGCGGAGTAACGTCTAGTTGAG
AATTGAAATAAGGTAGAATCAATTATAAGTCGCATAGACCCAGGTGGATT
GTAAGCACAGGCTCGACGGCTCCGTGAACTACTCATGAGTGACGGAATGT
GATAGACTCCCGGTTAAAATGTGGGGAGCATGAGGCTCCTCGGTGTAGTG
CTCAAGGACAGATACACTAGTAATCGATGAATTACGAGTGGGTTAATTCG
TATGGATATCGTCCTGTAGTCGTTCAAGCAATATGGGACAGGCGCTTCAC
TCCCATCAATCGCATAGTCTATTTTGGCTGTGACTATGGACATCCCAACG
CGACCCCTCCCCGCTTGCGACGACCGATCCCATACCCTCTAGGAGGCTCT
TGGGAGATCGTCTTAACCTCGGGTGGCTGCGTACCCCCGATAATTTCTCT
CCCCTCTATTGAAAGACATGTACGTTATCGGCAGGGGCATCATCGGTCCC
GCCCGTGACTCAGAACGCTTATAGATTGGGTATAGAGCTCCGCTAAGAGG
CCGCGACAATCATACTTACACTCTCTTCCTTTAAGTCACTGGCGTGTAGT
CCTGCTGACGATACGCTCTGGTGAAAGCGCACAACAGCCTACGGGTTGAG
CACGCCATGATTGCTTTTGGTGTGGGGCTGAGCTCACAACTGGTCACCAC
TGAAGACGGAGTCGAAAAACAGCATAATGGGTCAACGTCGTCATCTCGGT
> SEQUENCE 15 (Fri Sep 18 13:05:43 2020)
CTAATCTTTACCAACCGTCCGGCAAGTATCAAGCTAAGCAAACGGCAAGT
CACCGTGCTGACTAACCAGTACGTCTACGTAATTCTGGTGCGCTCTTGTC
GGCCTCGTTCCCGAGTCCGACATCAACGGCTCCGATATACACAGTAGGTT
GGCCTATGTTGACGACTTTCGGTGCTAGCTCCAAACCTTCTACGATAATC
GGACCGTATAAACAAAATCTTGAATCCTCAGTGATCCACTAGGTTAATAT
GGGGTAGTCATGTGTACAGACACCGATGATCAAGCAAACCTTACTTGATC
CGTCCCCAGATAGGGATCTTCATTTATCGGTCTGATGAATCGGACGATGA
AATCCAATCCCGGAGCCGCGGGAAGATCCTACCCACTAAGACACTCAACT
TTTCTTACGCTTTACCCCGTACTTAAGAACCGGCTAAGTCAAAGGGCGCG
CTTATGATGTATTCATAACTAAATTCGAATACTAAACTTTAATATGTTGC
AGGGACCACATCGCCATACCGGGACCTGGGAGACATCACCTGGTGCTGCA
AGCTATGGTTTTCCTCTTCCCCTGACATGAGAGCTTAGTACAAGGCAAAG
TGAGTTCATTCGGTTATCCCTTTATCTGTTGTCCACGAGGTTTCACCTAC
GACCCTTCGCAGAGTCTACATTTTCCAAAGATACAGTAGATTAAACGACC
GATTAGTTCCTCTTTGTGAGCTGGTCGTTCTACTACTTAAGCGGACTCCT
AATGTTTCGCATGCTTACTATGACGCACACGTCAAACAAATAACCCAGCA
ATACTGCTTACGGGCCATTGCTGGCATGCGAAATCCCTGGTGGTAGATGG
TATAACGTCCGTTATGGGGGTTAGCTTACTAATATGGGTGCGGTGGTTCT
TAGGGTTTTGCGCAGCTGATTCCTGTTCTCAAACTATTGGAGGCCGACTT
GTTGCAGCATGGTTAGAAACCTTAGGGAGTCTTGCCGTGAGACAACTGAC
GCCCGAGACGAACCGCAATGATATAGATATACCCCTGGCGTTGTTCGCTT
TCATCGGCCCGCCCAACGCCAGGCCGTCCGAACCTGCTTGGTCGGAGTGG
GGGTATGGGACTACAGCACCTCTTATGCAAATAATTCCCTTACGATTGCA
CGTCTCAGGCGCGACGGGCCGGTCTTCCCAGATATAAGCAATCCTTGATT
TACGCAGTAGTGGCTAGACTAAGACTATGGTGATGCTTGATAAACTCTTA
GGTACGTACCATATAATTAAAATTGCCTCTGCGCCTGGATCGAGTCGCTA
TACGACGTTACCGGTTGGCCCCCCGACGTACTAATTCGCTGGCCCATGCC
CGCGCAATTTATATCACTACGCGCTACCGCTATGCGCATCGGCACTAAAT
CGAGGACTCGCCATGGATCGATCCGCAGACTCCGTTACATGTCACATTCC
TGGTAGGTTTGTATGATCGAAGCGACAAAGCCGTCTACAACCACGCCATG
TCAAGCCCCATGTCCCTTAGCACGCAGGAAAAAGGACATCAAGACGTAGA
ACGATTTGAGGCCGCTAACTGGTTGTTGCTATTGGTCCGCGACGGCAGAC
GATACAGCAACGGAGTCAAACAGTAGAGCGGGCGGCGTCCAAGCCGTCTA
GTACACTCGGGTGCTGACGTTAATTTCATCACACCCAAAGGACGGGATTA
GGCAAATCCGGCCGTACTCGGGGGTTGCAAACATTCGCGCTTGAGGATAC
CTCTGCAAGAGACCCCATGAGACGCCTGTGCATGGGTTCATGTCTGCGCG
TAAGGTCGCGGACCGTAGTCCAGACGGTACATAGAAACGGGTCTAACACG
GTGCCATGCGTGTACTTTCATGTTTCGTCGACGCCCCACTTTGGTGGTCG
ACGTAAGTCATTGAGTCACAATATCCTCCGCGGTAGGAGTGTCCCCTTTA
GCGCATTCGGTTCTCGCATCGGCCCTGGCTGCATATTCTATCTTTACGGA
TGGCAAAGGATACCCCGCTCACTTCGCCGGCGCAGATTTCGACGCCTCCG
GGTAGCCAACGGACTTCGTGTTGCTCTCGCTTGGGGTTTAGCTATTTAAA
CAAGGTGCTGGCTTAGTAGACCGTTGCGACGCGAAACGACTCTGCAGCTT
CAGTGCAATGTAAAAATTCTCGGGGGGCCTCATGGCATAAACCTTTGTTG
ACAGCAAAGTGGACCCGGCAAGGTCAAATGAACCAGTTTGATGCCCCGTG
CCTGAGCTGCTTAAACTTTGGACTGATCAACGACGGGTACGTAGTGCACC
AAGTTGACAGAGGAACAAGATTGAACAGGAACACTAAGCTGCGTCCATCG
AATAGCCCACAGGAATCCTCACTATTTATGCAAAATCACGAACTTATGAT
GGCCCCCTTATGGAAGTAGCGGAACGATTTATAGGCAATAACGGTGAAAA
CAACTTTGCTCTAGCAGTCGATTGATATTAATCACCTACCCATACAGACC
> SEQUENCE 16 (Fri Sep 18 13:05:43 2020)
GCGTCAATTCAATTCTGCTATGCGGACGCGTTGGCGTCTCCTCTACGCAG
ATATTTTTGCTTTATCCGTTTTTACCGCATCGCGGGCACGTCTCCTACGG
GAGCAATACGCCGATCGTCGTGTCGCCCAAGTCGCAGTCCTCGGCACGGT
GGAAAGCAACAGTCGCCAAGGAACACAATCCTATTTTCTTCTTAGTATCA
CTTGTGAGAAATATGGCTCGCACAGACCTCAGAAACTTGGATTGCCAAAG
GTACCATCGCAATATAGCCACCGTGGGTCTACTCCTGAACCTAGAGACAA
TACTGATCCTAAGCCTGCGATCCCTCTTTGAAGCACCCCACTACATGCCC
AGCTTGCTAAGTACTCACACGCCTCCCCTCGCCTGGGCGAATACATGCGA
ATCTTCGAGAGAATAGTACCGAGGAAGTTGGGCCTTCGACTACGGAAGGT
AAAACCAACCACTTCAGTTGCCAGAAAGTCGTCGGCTAAGCATATACAGC
CATTACTTTACCACTTTAGAATGCGCGTTGTACTTGATCATCTTTGGAAT
TGCGTCTACAGCCACGATTTTTAACTCCCTTGCCTGTGGCGAGGCAGACG
GGACCTGCAGGCTAGTATTGTAGGCGTTCCGCAGAGGGCGACCACCAACT
CACTTGTATATTGGTACGGTAGGGAGACACGAGGCCTCATCAGCTCCTAG
CCCGACGCCCCTGCACGAGTAACCACTCTAACGACCAGATGTTTCTAAAT
GCGTTTGGGAGTCTGAGCGGTAAGAGACCGTTGTAGATGTACAGGCCCCG
CTTATATAACCGAAAAATGTTATTCATCCTGCCACCCAGCTGCGGTGTCT
ACTGCCAGCTTCGCACGAAGTAGGTAGCGCCCTATATTCGGCGAAGGTCA
ACAGCACTGAACCCGGTGTTAGGATATCTAGAGGGCCCTTGTAAGCCTCT
AAGCGCATTTGTGTTGCGCGATAGTAGAGAAATGGAGGGTATGCGAACAA
GCTCGGCTGACGGAACTCGTCATAATGTGACACCACTGAAACAGTCGAGT
AGCACACGTGCGCTTGGGGTAGCGGGAGCAAAATGTGAGGCGGAATAAAC
GCGAGCCTATATTCACAATAACGTAACCCAGCAATACGATACACAAGGTA
CCACGGTCGACAACCGTTAGCCGGACTATTTGCACGGCTGGGGTCGACGG
TAGACCCGTCCTTTCCTGCATGGCGGGTCTCTGATATTATATGTGAAGGT
GGACATCATGTGCCATCAAAAAACGGGGCCAAGTAAACGCTACTTTGAGG
ATAAGGTGTACGTCTGAATGGGCAGTTATGCTGCCTCTATAATACCCATG
CCGTCCCGAGGAATCAGCGTATGTCGCCTCACCCTTTACGTCGAACTCGG
ACCGCATGTTCGTGCCAGGCAACTAAATCTTATGATGGCAAGTCGCATAC
CAGCCGGTACACCTGCGTGTAGGTGGTGTGTGCAACGTCTATTTAAGTAA
CGACGAGACGTCTAGTCAGTTCCGGCATGAAGGCATACCGGATCGAGGAG
CGACTCACCGACCTTTTCCCATGGATACAAATACTGGAAGGATGTTGGTC
CGTTTTACTCAGCCACAATTGGTGGACGTTGGTATCCCGTAGCAGGAGCG
AGCGAGCATGCATTAGGGTATTAAAAAACTCGATGGTGTTGTTACTTAGT
GTTTTGATTAATAAGGAACTTTGACGTAGCTCCGGGCCCGCCATCTTGCC
GCGCGCGAGCCCGCGTTGCAGAACGAATAGTCGATTCTATTTTTCGCATA
ACTCTCCTTTGCCAGCGGACTGCTCATCTCACTATCTATTTTGTTTTGCT
TTCGAATATGAGTATTTCGACCGCGCCGATACGCCCTGATGTCCGACAAT
GACTATGGTGTAGGGGAGATCTAATCCCCTGATTGTGTAGGGCCCACAGG
GCGCTGCGAGGTAGAGAATTCGCGCGACGACCCTGAAAAATTGCTCCCGA
GGCTAGTGCCCACGACAACGGTAGATAGCCAATCCAAGAATTTGGATCTA
ATGACCACCACGAAGGGTTAACAAGGGACTAAGTTAAGGCTAGCACGAGT
CCCCTCTCCCCCCCGTCGGGAGACGGATGCTGCTGATCACTACTAGACCT
TAAGCGCGCTCCACTCGCTTCAGCTTTGTGTGCTCTTGGGAATAGACGTC
ATGGCGATTACGTGTGTGTCCCAGACGTGTATTGTGTCGAACGCCCCCTT
CTCCAGTAAGTGAAAAGCTGGAGCGTCTCGCGAACGCAGATTATTCTCCC
GCACATATTTACTTGGTGTGTTTGCTATTTGCCCCGCGCCGTAGCGCTAT
TTGTCAAGTGGCGATTGCGCTCCCATCAAGAGGTAGCTGTTTTGTTCGGC
GGACGTGCATCATTCCTTTGTGGAGACGCGGTCTCGTCACTCAACGCAAG
AGGGGGTTGACTCTGCAGTAACATCTTTATTTTGCCCGTTTGCGTAATAT
> SEQUENCE 17 (Fri Sep 18 13:05:43 2020)
TTAACCAAAGATGGGGCGCATAGACGCCATGCTTTAACCCACAGTTCTCA
TTTAACGTATGGCGGTGTCACGGAACTGTAATCCTTAGGAGGCGGAACCC
AGTTCTCGTATACTGCCTTATATACTTGTGCAACTGCGAGCTACTAAGGA
TGACCTTAGCTTGGACATCCGTCCCAGTGTCTCTGTCGATTACACAGACA
CGGCCGAAGAAGGTAATTTTTAGGCCTTAAGAAATTTCTTGTTTGCAGAA
TCGGACTGGGCCCAGCATACCCAAGTCAGACTTAAGATCTTTGGACGTTA
CTTCATCCGCGCTTGCCCATTGCGTACGAGTGTAGCTCAGGAGCGCTCGT
TTCTATCGGCCGATCAAGTTACCGTGAAGAGTTTTGGGAAGCGCGGCCTA
CGTGACTCAAAGAACCATTGCTTGCCACATCCACTTCATTTCACCACCCC
TGGTTCATATATTGGAGTCCCCCAATACATTTCCCATAGCACTCAGAGGC
GAGCGGATAGATTTGAAAGTTAGGGCTAACTATTCCGTGGCCCATAACAT
ACTTCGAAATGCGGGTCACTGGACGCGTGGATCATGTGTAACCTTATCAC
AAGCCAGCAAGTGGCAGCGGTCGACGGACTCGTGGATGCAACACAGTCCG
TAAATCCACGCAGCAGAGGCGTCCTACGTGTTCTATCCCAAAAGTATCTC
TCTCAGCGCCCAGTGTCTAGAAATCGCAAGCAGATTCCCGTGAGTCAGTA
GCGGTAGTTGATTGTCTATATAGATTATGATGTTGGCCGAATTTAATTTA
GAACACTAGAGCGGTGCCAGAACGTGTTGTAATAATCAGAGGTAGGAACA
GGAGGGCATCAACTGTGCACAAGTGCTCCGTCGCGACGATCGAGACAAAA
GATCCCATTCGGGGACGGGAAAGTCCCTCTCCGATCATCTTTACCTTCAA
CTCGGATACAGCACGCCACCACCCCTGGTACCCTATAACTCCCGGCATTC
CTCGGTTTACGTTTATCCTGGGCTGCGTTCGACACCTCATTATGCGTTGT
GGAAGCAGAACATAAGGCCGGCCGCCGAGTCTAAATTTAGGACCAAAGGC
ATCTAGAGAAACTTCTTAGCGCTTGTTCTGAACTCGATTCAATGATGTTT
CAATTACCTGTAGCTTCCTTAATCTACGAGCTCACACAAAATACTCGTAG
TCAGCCGACATTAGGTAGGCAAAAGAATCCAGAATAGTGTTATCTGTGCG
TTTTAGAATGCGGGGTACGGTGCTTCATAGAATGTGCACGTACTTACATA
AAGTCTAGGGCTAGGACAGGAGGGTTCCCGACGAATCGCAGGTATCCGCA
AGATTACCTTCTGGGATCATGTAGCCTTCCAACGATTTTGGCTTCTTCAC
TCACCCCAGAGACCGAGTCTAACGTGTGCACAGCCGGCTGCTTGTGGTAT
TCCCTCTACCGTCCTATTGGACGCATAATCATCACAACCATCAAATTTTA
GCCCCCGGTGGGGCTGGTTAATCAATTCGTACATAAATTGAGTTCGAAAG
TTACTTAGAATACGAGCTCCCTCCCCGCATAGTTGAGTCTTCGAGCGCGC
GACAGTGAGTCTGGCCCAGCTTACCACATGTTATTTCCTTAGCCGAACGC
TGGCCGGAGTGACGGTCCGGACACCATGTGGAGGATGGCCCTCTGACCTC
GTTGTATCTTTCTGTCTATTGCCTCACGGTACTAGGGATCGTGTCTACAG
CACCGTGGGGAGGCCCAGCCATGTCCCTATCGAGGGACAACATAGACGAA
GAAAGGTTAGCAGCGTCTGGCTAGCTTCTTCGCCACCATCTACTCCCTTT
CTCTATGCCTGTTTCCAGGACTAGCAGGTTTACAGCAACACATGGCCCAG
ACTTCCGAAAGTTGTCCATGCTAGGTTGATGTTAGACAAGCGGAATCCTG
GTCTAGAAGCCTAAGGGCCGTGACAATTAAACGCTGACGCAAGCTCAGGA
TTACACTTGACGTTCTGCCCCTAAATGGCGCGGGTTAAAGTGCAGCAGGG
AGCCGGAGGCGAAGGTCTTAGCGATGTAAGACGGAACTCAAGAGGTTCAC
GCGTGCGAGCAAGGAAGATCGTCTTCCAGCATATTTGTATAGGGCATCCG
AATGGACTAGTCCGACCTAATACGGTTCGCTCCTATATATTTAGAGGGCG
AGGGCCCATGTTGTGAGACTAGGACCGACGCACTTAACACGGCTCGTGCA
ATGGTTACCCGCCAACTCTAGTCAAGTTTACTCCGAATTTTTTGATCACG
AATGATACGCTCAGGGGCCTTAGCTTCACCAGAAATTCAAGATTAGACTC
TTCTTAATCTTACAGAATCGCAAGGTACAGAGCTAATTGTCGCATCGATT
GACACGTAGTGGTACCGTCCAAAAGATCCTGCTAATACATCCAAGAGATC
AGTTAATGATTGAACTGTTCATCCGCCAAGGGATCGAGTTAATCGCTATG
> SEQUENCE 18 (Fri Sep 18 13:05:43 2020)
GCTTCGTGCAGATAGTAACGTGCCCAGCAGACAAGGTGTCGTCGCATGCC
TATTCGCAGCAAAAGTTCCCGAATATGTATAGCTAACATGCGGTCATAAC
ACGGATAGTACAATCGGTCATCCTTCGCCAGGCACTTAGTTCGGCACAAT
CTACACTTCCCCGCACCATGGGGCATACTACACTATCCGGCTTGGGTTTC
CGGAGAGTTTACCCAAAACCACTTTGAGAGGACATTATGCTAAGTTGCCC
CCGGATGCCGTGGCGTTTGATTCGGGCTCGATTCAGCCTTCAGTGTCTAC
GTGGCGGAATTGCTGCTGAGGTTGGCAAGAGGATTTTACTTCAGGGTCGA
AATGCACTGATAAGCACTAACCTTCAGTGTCGCCGACTTCACAGAGTAAC
TTACCAAGCAAGATCGTTCTCACTGCCCGTTCTACTTTGAGACAGATGGC
CTAGAGTGCAATTCCGTCCTGGAGTATCTTCGTCCGCGCCATGGCTGTAC
GGCAATTTTCTACTAGTGACCGTATAGCGTGGCATTAAAGGAGCTCCAAA
GGGAAATCTTAATGGAGTCACTAGAGCTGTACATTATTAATCGAAAATAA
GCAGGCATCCTTACACCTAAGTGTTCGTGGACACAAGGTTGGTGGCTATG
GGATGTCGAATACTGTACCAGAAAAGGCACCGACTGATACATTTACTTTA
AAGCCACCCTGCGGCTCTAGACCCTCACCTGTACGTAGAACTCTACTGCT
GAATAGAGCCTGGGGCGGAAACCAGACACTTCAGAAAGACACCCGTTTCA
CTTATCCACTGAGATGTCTGTCGGGCCGCCCTCCCTTTCACTCGACTTCC
GCCCAGTACGCACCCTGCAATGATTAAATTTGCATCTTTCCGCGCGTCAC
ACCCATGCCCCAGGGGGCAATCCGTAGACTACTCGCCGAGCGAGAAAAAT
AGCTGTACGGGTCTCATATGAGAAACACTCCGATTCGGCACGTATTGGGC
AAATGTTTTTAGGTGAACGAAGATTTCGGTAGAAGCCGTGTACGGAAATA
CGCCTGTCGTGCGGACACACATGGGGAGCCTGTGGGGAAGGCCCGAAACC
CCTCCAGGGCATCAACGCAAACCATTTTGCTACGTTTATATAATTCTAAC
GAGAAAACGAACAGTTCCATGGCCTACTAGTAATTCCGTGAGCTGTAAGA
GATACGAGTGCTCCGGGATATCCATCTCAGCCGTTCTAATCCGTCTCTTC
CCCCCTTAATGCGGGTAGGGTCGACTGTGTCGTGCAATTTCTCCACGTAG
TAGTGACCACATTGGTGGAATGGGGGCAAGCGCCGCTAAACCCCCCACCA
ATCGCTTGGACTACCGGTTGCCGAGCCGGTACTGGAGTGAAGACGGCTTT
GAGCCATATCTGCCTGCTACCCGCTTTGGATAGAAGTCTTGCGTCACAAA
TTGCCACCAGATACTGTCAGACAGTTATAAGCGCTTGATATGCAAAGTCA
TACAGGCCATAATGTTGCTGTGAGTAGGTGGCTGAGAACACGCTTCCTGA
TGTTCCTTTCGAGGTATTCGAACTTCGAGGTACAACAGAACCCCAGAAGG
ATAGCCCACGTTCAGGGTATTCCGTAGGGAGTCTACAGAGATACTCATAC
GTGCTCCAGTTATGTGCTACCCACAAGCTGATCACCTAGGGACTCCCTCA
ATGTGAGCGAACGCCGACGGGCCGCAAAGGGTGTAGTATTGGCAAATCCG
TAAGAATCATGATACGAAGCCCGGCGCTCCAGTTCTGCTCATGGGTAAGA
AGCGCACAGTAGAAGTTTGCCCGTTGTTCAGACTTGGTAATTGTCCGAGG
TGATCCTCCTTTTCCTTTTAGAGTGCAACATTCCGGTTAGCCGTGCCCTC
AGGCGACTGGCCCTATGTAACCCGGTCCCCCCGGTGTTATGACTGTAAAA
TCGTTGGTACTTCAATCAAGATCGGGACTGTTTACTCTTTCGTCTGCGTT
TGGTTTTCACGGCCGATAAGGATCCTCCAGGATGGTTTAGGGTTAGCGGA
GATCGGACCCCACACCTCTATATTTAGACCAGCGCGAGTAGCGGGGAATT
TTGTGCTAAAGTCAAGAATCACCTTTTAGGGCGACCTCCCTCCTAGGCAG
ACGATTTCTATACACTACTCGGAAGTTGGGCTAGTGAGAGACATGTGGAT
GCTAGAGAGTCTCGGACTACTAGTTACAATACCGGAGTATGCGAACGTAA
AAGCCCCAAGAAGATATCTGGGAGGCGAAAACTCAGTTAGGAGATCCTTA
ATCATGCGTCCACTTGTGAAATGTCGACTTCTCCTACTCAGTAGTACAAG
ACTTTTCGACATCTTAACGTCGATCTTTCTCAGTGTCAGGCAACAAATAG
GACAGACGGAGACTCCAATTCTTCAAACATAGATTAAGCAGGGTACTGTA
ATATGAGATCAGAGCCTGTGCTTACATAATAATATTGTGATCTTGACACA
> SEQUENCE 19 (Fri Sep 18 13:05:43 2020)
CAAGTATCTTGTGCCATTTCGGCGACGCGGAGTAGCCAATAGAGCCTGGC
TACACACTTGATGGCGCTATGTCCACTGACAATTCTTCGTTAAGGATCGT
GCACTGGTCAGCCCATATCGGTGGTTGGAGCTGAGAATTGTGGGGCGTAT
GAGGTACAACCGACAGGTTGTTATGGGGCCTTCGGGGACGACCCCTCTGG
TTCGTTGGGCATACGTTAAAATTCCCCTAAGCTGGCCGGAGATTACCACC
CGTGAGGCGTTATCTGGCGGGAGGTCCACAAACGTAAAGAGGTCTTTTTG