Commit 74e676e4 authored by Axelle Loriot's avatar Axelle Loriot
Browse files

Auto-saving for axelle.loriot on branch master from commit 38f4ae17

parent 38f4ae17
Pipeline #79143 passed with stage
in 25 seconds
# Create dds object
dds <- DESeqDataSetFromMatrix(countData = counts,
colData = coldata,
design = ~ Condition)
# Inspect counts distribution
as_tibble(assay(dds)) %>%
gather(sample, value = counts) %>%
ggplot(aes(x = log2(counts + 1), fill = sample)) +
geom_histogram(bins = 20) +
facet_wrap(~ sample)
# Run DESeq2
dds <- DESeq(dds)
# Available results
dds$Condition <- relevel(dds$Condition, ref = "mock")
dds <- DESeq(dds)
rld <- rlogTransformation(dds)
plotPCA(rld, intgroup = "Condition")
plotPCA(rld, intgroup = "Condition", return = TRUE)
Version: 1.0
RestoreWorkspace: Default
SaveWorkspace: Default
AlwaysSaveHistory: Default
EnableCodeIndexing: Yes
UseSpacesForTab: Yes
NumSpacesForTab: 2
Encoding: UTF-8
RnwWeave: Sweave
LaTeX: pdfLaTeX
This diff is collapsed.
@DRR016707.1 DGTKZQN1:354:C2B0UACXX:5:1101:1199:1908 length=101
+DRR016707.1 DGTKZQN1:354:C2B0UACXX:5:1101:1199:1908 length=101
@DRR016707.2 DGTKZQN1:354:C2B0UACXX:5:1101:1245:1922 length=101
+DRR016707.2 DGTKZQN1:354:C2B0UACXX:5:1101:1245:1922 length=101
DRR016707.42561021 161 1 19626495 60 100M1S = 19626494 0 GTAACAATGTTATCAGTAATGCTTTAAACTAAAGCACCTGGTTATGCATTTGAAACCAAGTCTGTTTCTTGTTTTGTATTTTCTCTCTGGAAGTTGTAAGA ?8?B1:BDD,,2<:C<2A<<,+A?CBFFAE<+<+2A?EEBD99:D<*?B:*:D9B:DD/BDED@)=8=B;@=)).=(=@;7A)7.==>;3);@AAA>A@3; AS:i:-8 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:30C0C68 YT:Z:UP NH:i:1
DRR016707.42561021 81 1 19626494 60 101M = 19626495 0 TGTAACAATGTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGACACCAAGTCTGTTTCTTGTTTTGTATTTTCGCTCTGGAAGTTGTAAG (9(??==3??>==;5(55((6.((9>;..;67>)>).5(A;;>=/))8.=>9)((?AB?92=00*;=::1)=:3=74=A7<)0<+<AAAB?=<+4AA<;== AS:i:-5 ZS:i:-19 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:54A29T16 YT:Z:UP NH:i:1
> SEQUENCE 1 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 10 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 100 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 11 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 12 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 13 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 14 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 15 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 16 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 17 (Fri Sep 18 13:05:43 2020)
> SEQUENCE 18 (Fri Sep 18 13:05:43 2020)